Study population

This study was conducted as part of the CORDIOPREV study, which stands for Olive Oil CORonary Diet Intervention and Cardiovascular PREVention Study (Clinicaltrials.gov number NCT00924937). The study was conducted at the Reina Sofía Art Center in Córdoba, Spain. The study design included a single-center, randomized, single-blind, controlled dietary intervention. A total of 1,002 patients with his CHD were included, and detailed information on the rationale, study methods, inclusion and exclusion criteria, cardiovascular risk factors, and patient baseline characteristics was recently published. [13]. Briefly, eligible patients must be 20 years of age with established CHD, no clinical coronary events within the past 6 months, able to continue long-term dietary intervention, and no severe symptoms. Included were men and women aged from 75 years. If the illness or expected life expectancy is shorter than the study period. The upper age limit was set based on life expectancy at the time of trial conception (2007) and was consistent with normal practice in contemporary long-term cardiovascular research.

Written informed consent was obtained from all participants before participating in the study. This study protocol received approval from the Human Research Review Board of the Reina Sofia Center for the Arts in accordance with the guidelines of institutional and good clinical practice.

The primary objective of the CORDIOPREV study is to evaluate the effectiveness of a Mediterranean diet compared with a low-fat diet in preventing clinical events and mortality in patients with pre-existing CHD through a long-term follow-up study. Here we report the results of his T2DM incidence, one of the secondary outcomes of the CORDIOPREV study. The study included 462 of 1002 patients who had not been diagnosed with T2DM at the start of the study. Among non-T2DM patients at baseline, 107 patients developed T2DM (incident-T2DM) according to the American Diabetes Association (ADA) diagnostic criteria. [14], after a median follow-up of 60 months. In this study, his 19 patients were excluded due to missing TL data. Therefore, the final sample consisted of 338 non-T2DM and 105 incident T2DM (Additional Figure 1). Each year, the incidence of T2DM was assessed according to the ADA’s T2DM criteria: fasting plasma glucose ≥ 126 mg/dL or 75 g oral glucose tolerance test 2-hour plasma glucose ≥ 200 mg/dL or glycosylated hemoglobin (HbA1c). ) level ≥ 6.5%. In the absence of clear hyperglycemia, diagnosis requires two abnormal test results from the same sample or his two separate test samples. [14].

Sample size and power calculations for this sub-study were calculated based on the following assumptions: T2DM incidence in the Mediterranean diet group was 10%, in the low-fat group 17%, and statistical power was 80%. One-tailed α = 0.05. Based on these assumptions, the required sample size of 163 patients in each dietary intervention group was established, assuming an estimated loss of 10%. The current study included all subjects who were not clinically diagnosed with T2DM at baseline (n = 462; 216 low-fat diet and 246 Mediterranean diet). Of this group, all 107 subjects who developed T2DM were included (42 on low-fat diet, 65 on Mediterranean diet). The remaining 355 subjects were not diagnosed with T2DM (174 on a low-fat diet and 181 on a Mediterranean diet) (Additional Figure 1).

Randomization and masking

Randomization was performed by the Andalusian School of Public Health (1:1 ratio). The dietitian was the only member of the intervention team who knew about each participant’s dietary group. Briefly, randomization was done based on the following variables: gender (male, female), age (<60 years and above 60 years), history of myocardial infarction (yes, no). Details regarding randomization have been previously reported and summarized. [15].

dietary intervention

Patients were randomly assigned to receive one of two different healthy eating models. (1) At least 35% of calories come from fat (22% monounsaturated, 6% polyunsaturated, <10% saturated), 15% from protein, and up to 50% from carbohydrates, and (2) Low-fat diet with less than 30% total fat (12-14% monounsaturated fatty acids, 6-8% polyunsaturated fatty acids, less than 10% saturated fatty acids) as recommended by the National Cholesterol Education Program, 15 % protein and a minimum of 55% carbohydrates. In both diets, the cholesterol content was adjusted to less than 300 mg/day. This study was conducted over a 5-year follow-up period.Details regarding the diet have been previously reported and summarized [15].

Patients underwent individual face-to-face interviews with a dietitian at baseline and annually and completed a 137-item semi-quantitative food frequency questionnaire previously validated in Spain. [16].Annual 14-item Mediterranean Diet Adherence Screening [17] A 9-item dietary screen was used to measure adherence to the Mediterranean diet and to assess adherence to the low-fat diet. Additionally, both intervention groups received the same intensive dietary counseling. A nutritionist conducted individual one-on-one interviews with her at baseline and every six months. Additionally, quarterly educational collective sessions were held with individual sessions for each group with up to 20 participants each session.

Laboratory measurements

At the beginning of the study and once a year during follow-up, venous blood samples were collected from participants into EDTA tubes (0.1% EDTA final concentration) after a 12-hour overnight fast, and plasma was separated from red blood cells. Cells were separated by centrifugation at 1500 × g for 15 min at 4 °C and immediately frozen at −80 °C. Biochemical measurements were performed at the Reina Sofia Center for the Arts by individuals blinded to the intervention. Lipid variables were assessed using a DDPPII Hitachi modular analyzer (Roche, Basel, Switzerland) using specific reagents (Boehringer-Mannheim, Mannheim, Germany). Plasma triglyceride and cholesterol concentrations were analyzed by enzymatic procedures. High-density lipoprotein cholesterol (HDL-c) was measured after precipitation of plasma aliquots with dextran sulfate Mg2+. Low-density lipoprotein cholesterol (LDL-c) concentration was calculated by the Friedewald equation using the following formula: LDL-c = total cholesterol − (HDL-c + triglycerides / 5). Glucose measurement was performed by the hexokinase method. High-sensitivity C-reactive protein (hs-CRP) was measured by ELISA technology (BioCheck, Inc., Foster City, CA, USA).

Isolation of DNA from blood samples

DNA was isolated from the buffy coat fraction by salting out method [18]Use 10 mL of Montreal-Baltimore buffer (0.32 M sucrose, 0.1 mM Tris-HCl, pH 7.5, 0.025 mM MgCl2, 1% Triton X-100) and mix and centrifuge to separate the nuclear fraction. . Nuclear pellets were homogenized with 3 mL of nuclear lysis buffer (10 mM Tris-HCl, pH 8.2, 2 mM EDTA, 0.4 M NaCl) and 10% SDS and proteinase K. DNA was precipitated with 6M NaCl and washed 100%. %ethanol. Finally, genomic DNA was extracted and resuspended in 500 μL of 1× TE buffer. DNA purity and concentration were assessed by spectrophotometry using a NanoDrop ND-2000 (ThermoFisher, Waltham, MA).

Quantitative PCR analysis of TL

TL was determined using the Cawthon method by qPCR. [19]. For all samples, we estimated the relative ratio of telomere repeat copy number (T) normalized to a single-copy gene, the Homo sapiens ribosomal protein L13a gene. RPL13a (S). Each PCR result was relativeized to a standard curve constructed using reference DNA samples.with telomeres RPL13aGenetic PCR consisted of eight DNA reference standards (1–25ng). All PCRs were performed using an iQ5-BIORAD thermal cycler and SensiFAST SYBR Lo-ROX kit (Bioline). The coefficient of variation (%CV) was 9.32% for telomere repeat copy number and 6.76% for single copy gene copy number. Thermal cycler profiles for both amplicons started with a 3 min incubation at 95 °C to activate the polymerase, followed by 40 cycles of 5 s at 95 °C and 15 s at 54 °C. . The composition of the reaction mixture was the same except for the oligonucleotide primers: 20 ng template DNA, 1× SensiFAST SYBR Lo-ROX, 200 nM reverse primer, and 200 nM forward primer. The final volume of each PCR reaction was 20 μL. The primer sequence was (5’→ 3′).

TeloFw, CGGTTTGTTTGGGTTTGGGTTT GGGTTTGGGTTTGGGTT; TeloRw, GGCTTGCCTTACCC TTACCCTTACCCTTACCCTTACCCT; RPL13aFw, CCTGGAGGAGAAGAGGAAAAGAGA; RPL13aRw, TTGAGGACCTCTGTGTATTTGTCAA.

DNA extraction and TL measurements were performed at baseline and 4 years. Although assessing TL at additional time points may provide further valuable insights, no statistically significant changes in TL were observed at 4 years in the present study. This study evaluates the role of her TL at baseline as a marker for identifying individuals at risk for short TL (TL < 20th percentile).

statistical analysis

Statistical analyzes were performed using STATA 14 (STATA Corp., Texas, USA). Means and standard errors of the means (mean ± SEM) were used for continuous variables and percentages were used for categorical variables. All p-values ​​are two-tailed; p<0.05 was considered statistically significant.

Defining the shortest TL rather than the average TL is associated with telomere dysfunction and cell survival restriction [20, 21]. Patients were thus classified according to their risk of short TL at baseline, defined as TL below the 20th percentile, and no risk as TL above the 20th percentile, as previously reported. [22,23,24].

Student’s ampere was used for comparisons between groups. Categorical variables were compared using the chi-square test. Fisher’s exact test was used to assess the relationship between participants’ she-T2DM incidence and risk of short-term TL. A mosaic plot has been applied to show the relationship between the incidence of T2DM and the risk of short TL, where the height of the bar represents the proportion of participants at high or low risk of short telomeres, and the width of each bar is proportional to the incidence of T2DM. A logistic regression model was performed to assess her risk of developing T2DM according to the risk of short telomeres. We used Cox proportional hazards regression to test the potential predictive value of TL and the potential role of his TL for selecting dietary models that reduce the risk of developing diabetes. Additionally, we conducted statistical analyzes to assess the interaction by dietary group and risk of short-term TL in a Cox regression model. Regression analyzes were adjusted for age, sex, body mass index (BMI), waist circumference (WC), HbA1c, HDL-c, triglycerides, and family history of both diabetes and early coronary heart disease. As an additional analysis, receiver operating characteristic curve (ROC) analysis was performed to assess the potential of TL to classify populations of incident T2DM and non-T2DM patients. We ran two models. The first is based on clinical variables (BMI, age, gender, triglyceride and statin use) and the second is a model adding his TL.